Filter By
Filter By
Brand
Brand
Categories

Category: Home

Reference: L21-09-01
€0.00 (tax incl.)
The working solution used for diluting lipid substrates.
Reference: L21-09-05
€0.00 (tax incl.)
The working solution used for diluting lipid substrates.
Reference: L21-09-20
€0.00 (tax incl.)
The working solution used for diluting lipid substrates.
Reference: L01-09-01
€0.00 (tax incl.)
The 5x stock solution of buffer used for assaying lipid kinase proteins.
Reference: L01-09-05
€0.00 (tax incl.)
The 5x stock solution of buffer used for assaying lipid kinase proteins.
Reference: L01-09-20
€0.00 (tax incl.)
The 5x stock solution of buffer used for assaying lipid kinase proteins.
Reference: M40-09-25
€0.00 (tax incl.)
25μl volume of 2.5M MnCl2 solution for different enzyme assays.
Reference: N01-09-01
€0.00 (tax incl.)
Stock solution of buffer used for assaying ubiquitin enzymes.
Reference: N01-09-05
€0.00 (tax incl.)
Stock solution of buffer used for assaying ubiquitin enzymes.
Reference: N01-09-20
€0.00 (tax incl.)
Stock solution of buffer used for assaying ubiquitin enzymes.
Reference: L51-39-500
€0.00 (tax incl.)
10x stock solution used for assaying protein kinase activity of PKC family members. Vortex or sonicate prior to use.
Reference: CL01-58-500
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for 3CLpro.
Reference: CL01-58-1000
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for 3CLpro.
Reference: A05-58
€0.00 (tax incl.)
The AKT (PKB) Substrate peptide sequence (CKRPRAASFAE) is based on the N-terminus of GSK3.
Reference: A08-58
€0.00 (tax incl.)
The AKT (SGK) Substrate peptide sequence (RPRAATF) is based on the N-terminus of GSK3.
Reference: C08-58
€0.00 (tax incl.)
The synthetic peptide (RRRADDSDDDDD) contains serine protein kinase phosphorylation site surrounded by acidic residues and is high selectively evaluated as a substrate for CK2 family kinases.
Reference: G50-58
€0.00 (tax incl.)
The GSK3 sub peptide sequence (YRRAAVPPSPSLSRHSSPHQ(pS)EDEEE) is based on human muscle glycogen synthase 1 (amino acid 636-661).
Reference: E27-58
€0.00 (tax incl.)
The HER2 Substrate synthetic peptide [AAEEIYAARRG] is routinely evaluated as a substrate for HER2.
Reference: A05-58B
€0.00 (tax incl.)
The Modified AKT Substrate peptide sequence (modified-CKRPRAASFAE) is based on the N-terminus of GSK3.
Reference: A05-58C
€0.00 (tax incl.)
The Modified AKT Substrate II peptide sequence (modified-CKRPRAASFAE) is based on the N-terminus of GSK3.
Reference: A16-58B
€0.00 (tax incl.)
The Axltide peptide sequence (CKKSRGDYMTMQIG) is based on the mouse Insulin receptor substrate 1 (amino acid 979-989).
Reference: C01-58B
€0.00 (tax incl.)
The modified PKA Substrate peptide sequence (modified-CGRTGRRNSI-amide) is based on the cAMP-dependent protein kinase inhibitor alpha (amino acid 15-23).
Reference: P03-58
€0.00 (tax incl.)
The synthetic peptide (IPTTPITTTYFFFKKK) contains serine/threonine protein kinase phosphorylation sites and is routinely evaluated as a substrate for p38 family kinases.
Reference: C01-58
€0.00 (tax incl.)
The PKA sub peptide sequence (CGRTGRRNSI-amide) is based on the cAMP-dependent protein kinase inhibitor alpha (amino acid 15-23).
Reference: PL01-58-500
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for PLpro.
Reference: PL01-58-1000
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for PLpro.
Reference: P50-58-1000
€0.00 (tax incl.)
The PP1/PP2A Substrate peptide [GRPRTS(p)SFAEG] is derived from human GSK3b (glycogen synthase kinase-3 beta) (amino acids 3-13) and is suitable as PP1 and PP2A substrate.
Reference: P51-58-1000
€0.00 (tax incl.)
The PP2B Substrate peptide [DLDVPIPGRFDRRV(p)SVAAE] is derived from bovine PRKAR2A (cAMP-dependent protein kinase type II-alpha regulatory subunit) (amino acids 82-100) and is suitable as PP2B substrate.
Reference: S06-58
€0.00 (tax incl.)
The RSK sub peptide sequence (KRRRLSSLRA) is based on human 40S ribosomal protein S6 (amino acid 230-239).
Reference: S05-58
€0.00 (tax incl.)
The S6K sub peptide sequence (KRRRLASLR) is based on human 40S ribosomal protein S6 (amino acid 230-238).
Reference: S30-58
€0.00 (tax incl.)
The SRC sub peptide sequence (KVEKIGEGTYGVVYK-amide) is based on the p34cdc2 (amino acid 6-20).
Reference: T71-58
€0.00 (tax incl.)
The synthetic peptide Tyrosine Kinase Substrate-3 (RRLIEDAEYAARG) is derived from human SRC (amino acid 412-422) and considered to be a generic substrate for various protein tyrosine kinases.
Reference: U06-57-10
€0.00 (tax incl.)
The ubiquitin-based proluciferin substrate is based on the C-terminal derivative of Ubiquitin.
Reference: S293-57-10
€0.00 (tax incl.)
The SUMO1-based proluciferin substrate is based on the C-terminal derivative of SUMO1.
Reference: N263-57-10
€0.00 (tax incl.)
The NEDD8-based proluciferin substrate is based on the C-terminal derivative of NEDD8.
Reference: D53-58-05
€0.00 (tax incl.)
The synthetic double-stranded oligonucleotide (Sense: 5’- GATCCGACGACGACGCGCGCGCGACGACGAGATC; Anti-sense: 5’- GATCTCGTCGTCGCGCGCGCGTCGTCGTCGGAC) is used as a substrate for DNA methyltransferase 3A (DNMT3A).
Reference: M323-58-025
€0.00 (tax incl.)
The synthetic single-stranded 27 base’s oligo ribo-nucleotide is used as a substrate for assay of methyltransferase METTL3/METTL14 complex.
Reference: P62-58-25
€0.00 (tax incl.)
The synthetic poly (deoxyinosinic-deoxycytidylic) acid sodium salt – double-stranded polymer (synthesized as 1:1 ratio) is used as a substrate for DNA methyltransferases.
Reference: P421-59-05
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P421-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P426-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P426-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P422-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P422-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P427-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P427-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P424-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P424-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P429-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.

Menu

Settings