Home (2)

SS(no Galnac)-Inclisiran

Reference: HY-143220

€0.00 (tax incl.)

SS(no Galnac)-Inclisiran is a single stran Inclisiran with no GalNAc. Inclisiran is a double-stranded small interfering RNA (siRNA) molecule that inhibits the transcription of PCSK-9.

SpectroCHIP® Kit (2x96)

Reference: 10610

€0.00 (tax incl.)

Chip Format: 96

SpectroCHIP® Kit (2x384)

Reference: 10510

€0.00 (tax incl.)

Chip Format: 384

SpectroCHIP® Kit (10x96)

Reference: 10600

€0.00 (tax incl.)

Chip Format: 96

SpectroCHIP® Kit (10x384)

Reference: 10500

€0.00 (tax incl.)

Chip Format: 384

SpectroCHIP® CPM Kit (2x96)

Reference: 10610F

€0.00 (tax incl.)

Chip Format: 96-CPM

SpectroCHIP® CPM Kit (2x384)

Reference: 10510D

€0.00 (tax incl.)

Chip Format: 384-CPM

SpectroCHIP® CPM Kit (10x96)

Reference: 10600F

€0.00 (tax incl.)

Chip Format: 96-CPM

SpectroCHIP® CPM Kit (10x384)

Reference: 10500D

€0.00 (tax incl.)

Chip Format: 384-CPM

SPC5001 is a locked nucleic acid (LNA)-modifed antisense oligonucleotide (ASO) complementary to human PCSK9 (proprotein convertase subtilisin/kexin type 9) mRNA. SPC5001 can be used for the research of...

SM-102

Reference: HY-134541

€0.00 (tax incl.)

SM-102 is an ionizable amino lipid that can be used for the formation of lipid nanoparticles (LNPs). SM-102 has the potential for development of lipid nanoparticles for delivery of mRNA-based vaccines.

SiRNA Negative Control

Reference: HY-150150

€0.00 (tax incl.)

SiRNA Negative Control is a siRNA of 21 nucleotides, and can be used as a negative control.

siPOOL transfection optimization service

Reference: si-V030-000002

€0.00 (tax incl.)

siPOOL species cross-reactivity check service

Reference: si-V050-000004

€0.00 (tax incl.)

siPOOL rescue sequence design service

Reference: si-V010-RES010

€0.00 (tax incl.)

siPOOL positive/negative/transgene control 5

Reference: si-C005-XXXXXX

€0.00 (tax incl.)

siPOOL positive/negative/transgene control 40

Reference: si-C040-XXXXXX

€0.00 (tax incl.)

siPOOL positive/negative/transgene control 20

Reference: si-C020-XXXXXX

€0.00 (tax incl.)

siPOOL positive/negative/transgene control 2

Reference: si-C002-XXXXXX

€0.00 (tax incl.)

siPOOL positive/negative/transgene control 10

Reference: si-C010-XXXXXX

€0.00 (tax incl.)

siPOOL human RNA Binding Protein library 1 extension

Reference: si-L210-002RBP

€0.00 (tax incl.)

siPOOL human RNA Binding Protein library 1

Reference: si-L210-001RBP

€0.00 (tax incl.)

siPOOL human RNA Binding Protein library 0.5 extension

Reference: si-L205-002RBP

€0.00 (tax incl.)

siPOOL human RNA Binding Protein library 0.5

Reference: si-L205-001RBP

€0.00 (tax incl.)

siPOOL human RNA Binding Protein library 0.25 extension

Reference: si-L202-002RBP

€0.00 (tax incl.)

siPOOL human RNA Binding Protein library 0.25

Reference: si-L202-001RBP

€0.00 (tax incl.)

siPOOL human RNA Binding Protein library 0.1 extension

Reference: si-L201-002RBP

€0.00 (tax incl.)

siPOOL human RNA Binding Protein library 0.1

Reference: si-L201-001RBP

€0.00 (tax incl.)

siPOOL human kinase library 1

Reference: si-L110-000505

€0.00 (tax incl.)

siPOOL human kinase library 0.5

Reference: si-L105-000505

€0.00 (tax incl.)

siPOOL human kinase library 0.25

Reference: si-L102-000505

€0.00 (tax incl.)

siPOOL human kinase library 0.1

Reference: si-L101-000505

€0.00 (tax incl.)

siPOOL gene cross-reactivity check service

Reference: si-V040-000003

€0.00 (tax incl.)

siPOOL dose response optimization service

Reference: si-V020-000001

€0.00 (tax incl.)

siPOOL 5 kit

Reference: si-K005-XXXXXX

€0.00 (tax incl.)

siPOOL 5

Reference: si-G050-XXXXXX

€0.00 (tax incl.)

siPOOL 40 kit

Reference: si-K040-XXXXXX

€0.00 (tax incl.)

siPOOL 40

Reference: si-G400-XXXXXX

€0.00 (tax incl.)

siPOOL 20 kit

Reference: si-K020-XXXXXX

€0.00 (tax incl.)

siPOOL 20

Reference: si-G200-XXXXXX

€0.00 (tax incl.)

siPOOL 2 (for orders of 10 siPOOLs or more)

Reference: si-G020-XXXXXX

€0.00 (tax incl.)

siPOOL 10 kit

Reference: si-K010-XXXXXX

€0.00 (tax incl.)

siPOOL 10

Reference: si-G100-XXXXXX

€0.00 (tax incl.)

siPOOL 1 (for orders of 100 siPOOLs or more)

Reference: si-G010-XXXXXX

€0.00 (tax incl.)

siPOOL 0.1 Positive/Negative Control Sample

Reference: si-S001-XXXXXX

€0.00 (tax incl.)

Single Barcode-3' Construct in pScribe5-Venus-Puro, compatible with CloneTracker XP 1M/10M (virus)

Reference: BCXP3VP-V

€0.00 (tax incl.)

Barcode seq NOT in CloneTracker XP™ 1M/10M Lib (pScribe4/5/6)

Single Barcode-3' Construct in pScribe5-Venus-Puro, compatible with CloneTracker XP 1M/10M (plasmid)

Reference: BCXP3VP-P

€0.00 (tax incl.)

Barcode seq NOT in CloneTracker XP™ 1M/10M Lib (pScribe4/5/6)

Single Barcode-3' Construct in pScribe4M-RFP-Puro, compatible with CloneTracker XP 5M/50M (virus)

Reference: BCXP3RPM-V

€0.00 (tax incl.)

Barcode seq NOT in CloneTracker XP™ 5M/50M Lib (pScribe4M/5M/6M) - BC14(ACACCAGTTGTGCA)-21nt-BC30(TGCATGGTCAGTTGCATGGTCAACACGTCA)

Single Barcode-3' Construct in pScribe4M-RFP-Puro, compatible with CloneTracker XP 5M/50M (plasmid)

Reference: BCXP3RPM-P

€0.00 (tax incl.)

Barcode seq NOT in CloneTracker XP™ 5M/50M Lib (pScribe4M/5M/6M) - BC14(ACACCAGTTGTGCA)-21nt-BC30(TGCATGGTCAGTTGCATGGTCAACACGTCA)

Single Barcode-3' Construct in pScribe4HM-RFP-Hygro, compatible with CloneTracker XP 5M/50M (virus)

Reference: BCXP3RHM-V

€0.00 (tax incl.)

Barcode seq NOT in CloneTracker XP™ 5M/50M Lib (pScribe4M/5M/6M) - BC14(ACACCAGTTGTGCA)-21nt-BC30(TGCATGGTCAGTTGCATGGTCAACACGTCA)

Single Barcode-3' Construct in pScribe4HM-RFP-Hygro, compatible with CloneTracker XP 5M/50M (plasmid)

Reference: BCXP3RHM-P

€0.00 (tax incl.)

Barcode sequence is NOT in CloneTracker XP™ 5M/50M Libraries (pScribe4M/5M/6M)) - BC14(ACACCAGTTGTGCA)-21nt-BC30(TGCATGGTCAGTTGCATGGTCAACACGTCA)

Single Barcode-3' Construct in pScribe4-RFP-Puro, compatible with CloneTracker XP 1M/10M (virus)

Reference: BCXP3RP-V

€0.00 (tax incl.)

Barcode seq NOT in CloneTracker XP™ 1M/10M Lib (pScribe4/5/6)

Single Barcode-3' Construct in pScribe4-RFP-Puro, compatible with CloneTracker XP 1M/10M (plasmid)

Reference: BCXP3RP-P

€0.00 (tax incl.)

Barcode seq NOT in CloneTracker XP™ 1M/10M Lib (pScribe4/5/6)

shNT Control (non-targeting) in pRSIT17-U6Tet-(sh)-CMV-TetR-GFP-Puro (virus)

Reference: SHCTL-NT-pRSIT17-V

€0.00 (tax incl.)

shNT is OK for Human and Mouse

shNT Control (non-targeting) in pRSIT17-U6Tet-(sh)-CMV-TetR-GFP-Puro (plasmid)

Reference: SHCTL-NT-pRSIT17

€0.00 (tax incl.)

shNT is OK for Human and Mouse

shNT Control (non-targeting) in pRSIT16-U6Tet-(sh)-CMV-TetR-RFP-Puro (virus)

Reference: SHCTL-NT-pRSIT16-V

€0.00 (tax incl.)

shNT is OK for Human and Mouse

shNT Control (non-targeting) in pRSIT16-U6Tet-(sh)-CMV-TetR-RFP-Puro (plasmid)

Reference: SHCTL-NT-pRSIT16

€0.00 (tax incl.)

shNT is OK for Human and Mouse

shNT Control (non-targeting) in pRSI17-U6-(sh)-UbiC-GFP-Puro (virus)

Reference: SHCTL-NT-pRSI17-V

€0.00 (tax incl.)

shNT is OK for Human and Mouse

shNT Control (non-targeting) in pRSI17-U6-(sh)-UbiC-GFP-Puro (plasmid)

Reference: SHCTL-NT-pRSI17

€0.00 (tax incl.)

shNT is OK for Human and Mouse

shNT Control (non-targeting) in pRSI16-U6-(sh)-UbiC-RFP-Puro (virus)

Reference: SHCTL-NT-pRSI16-V

€0.00 (tax incl.)

shNT is OK for Human and Mouse

shNT Control (non-targeting) in pRSI16-U6-(sh)-UbiC-RFP-Puro (plasmid)

Reference: SHCTL-NT-pRSI16

€0.00 (tax incl.)

shNT is OK for Human and Mouse