Category: Research kits

Filter By
Brand: Krishgen Brand: Signalchem Clear all
KRIBIOLISA™ Protein L Ligand Detection Kit KRIBIOLISA™ Protein L Ligand Detection Kit

KRIBIOLISA™ Protein L Ligand Detection Kit

Reference: KBBP50
€0.00 (tax incl.)
Enzyme Immunoassay for the Quantitative determination of Protein L Ligand Detection from medium containing immunoglobulin (Ig) or Ig-fragments
KRIBIOLISA™ Insect Cell Host Cell DNA Kit KRIBIOLISA™ Insect Cell Host Cell DNA Kit

KRIBIOLISA™ Insect Cell Host Cell DNA Kit

Reference: KBBR03
€0.00 (tax incl.)
For the production of biotechnological products, expression of therapeutic proteins in insect cells is commonly used. Due to which there is a possibility of DNA contamination from the host cells in the products which...
KRIBIOLISA™ CHO Host Cell DNA Kit KRIBIOLISA™ CHO Host Cell DNA Kit

KRIBIOLISA™ CHO Host Cell DNA Kit

Reference: KBBR02
€0.00 (tax incl.)
Immunoassay for the measurement of HEK Host Cell Proteins. For the production of biotechnological products, expression of therapeutic proteins in CHO cells is commonly used. Due to which there is a possibility of DNA...
KRIBIOLISA™ E.coli Host Cell DNA Kit KRIBIOLISA™ E.coli Host Cell DNA Kit

KRIBIOLISA™ E.coli Host Cell DNA Kit

Reference: KBBR01
€0.00 (tax incl.)
For the production of biotechnological products, expression of therapeutic proteins in E.coli cells is commonly used. Due to which there is a possibility of DNA contamination from the host cells in the products which...
KRIBIOLISA™ Human IgG4 KRIBIOLISA™ Human IgG4

KRIBIOLISA™ Human IgG4

Reference: KBI1007
€0.00 (tax incl.)
Immunoassay for the quantification of Human IgG in cell culture and biological samples. About the kit: - Uses anti-idiotypic antibodies sourced from our vendor partner in the US, which ensures higher specificity,...
KRISHZYME™ Prekallikrein Activator Assay Kit KRISHZYME™ Prekallikrein Activator Assay Kit

KRISHZYME™ Prekallikrein Activator Assay Kit

Reference: KBBA30EP
€0.00 (tax incl.)
KRISHZYME Plasma Kallikrein Activitor Assay Kit utilizes the ability of active plasma kallikrein to cleave a synthetic pNA-based peptide substrate to release pNA, which can be easily quantified using a microplate...
KRISHZYME™ Hyaluronidase Enzymatic Assay Kit KRISHZYME™ Hyaluronidase Enzymatic Assay Kit

KRISHZYME™ Hyaluronidase Enzymatic Assay Kit

Reference: KBBA05
€0.00 (tax incl.)
Enzymatic Assay for Quantification of Hyaluronidase activity in cell culture supernatant and pharmaceutical preparations Hyaluronidase is a family of enzymes that degrade hyaluronic acid by catalyzing the hydrolysis...
KRISHZYME™ Tinzaparin Factor Xa Assay Kit KRISHZYME™ Tinzaparin Factor Xa Assay Kit

KRISHZYME™ Tinzaparin Factor Xa Assay Kit

Reference: KBBA04T
€0.00 (tax incl.)
Tinzaparin Factor Xa is a chromogenic assay intended for the quantitative determination of Tinzaparin in purified solutions by measurement of factor Xa inhibition activity.
KRISHZYME™ Tinzaparin Factor IIa Assay Kit KRISHZYME™ Tinzaparin Factor IIa Assay Kit

KRISHZYME™ Tinzaparin Factor IIa Assay Kit

Reference: KBBA03T
€0.00 (tax incl.)
Tinzaparin Factor lla is a chromogenic assay intended for the quantitative determination of Tinzaparin in purifiedsolutions by measurement of factor IIa inhibition activity.
KRISHZYME™ Nadroparin Factor Xa Assay Kit KRISHZYME™ Nadroparin Factor Xa Assay Kit

KRISHZYME™ Nadroparin Factor Xa Assay Kit

Reference: KBBA04N
€0.00 (tax incl.)
Nadroparin Factor Xa is a chromogenic assay intended for the quantitative determination of Nadroparin in purified&solutions by measurement of factor Xa inhibition activity.
KRISHZYME™ Nadroparin Factor IIa Assay Kit KRISHZYME™ Nadroparin Factor IIa Assay Kit

KRISHZYME™ Nadroparin Factor IIa Assay Kit

Reference: KBBA03N
€0.00 (tax incl.)
Nadroparin Factor lla is a chromogenic assay intended for the quantitative determination of Nadroparin in purified&solutions by measurement of factor IIa inhibition activity.
KRISHZYME™ Enoxaparin Factor Xa Assay Kit KRISHZYME™ Enoxaparin Factor Xa Assay Kit

KRISHZYME™ Enoxaparin Factor Xa Assay Kit

Reference: KBBA04ES
€0.00 (tax incl.)
Chromogenic assay for testing Enoxaparin in purified systems by measurement of factor Xa inhibition, in compliance with pharmacopoeias (EP/BP) and FDA guidelines About the kit: - Uses anti-idiotypic antibodies...
KRISHZYME™ Enoxaparin Factor IIa Assay Kit KRISHZYME™ Enoxaparin Factor IIa Assay Kit

KRISHZYME™ Enoxaparin Factor IIa Assay Kit

Reference: KBBA03ES
€0.00 (tax incl.)
Chromogenic assay for testing Enoxaparin in purified systems by measurement of factor IIa inhibition, in compliance with pharmacopoeias (EP/BP) and FDA guidelines About the kit: - Uses anti-idiotypic antibodies...
KRISHZYME™ Heparin Factor Xa Assay Kit KRISHZYME™ Heparin Factor Xa Assay Kit

KRISHZYME™ Heparin Factor Xa Assay Kit

Reference: KBBA04S
€0.00 (tax incl.)
Chromogenic assay for testing Heparins (UFH) in purified systems by measurement of Factor Xa inhibition, in compliance with EP Pharmacopoeia. About the kit: - Uses anti-idiotypic antibodies sourced from our vendor...
KRISHZYME™ Heparin Factor Xa Assay Kit - 200 Tests KRISHZYME™ Heparin Factor Xa Assay Kit - 200 Tests

KRISHZYME™ Heparin Factor Xa Assay Kit - 200 Tests

Reference: KBBA04
€0.00 (tax incl.)
Heparin Factor Xa is a chromogenic assay intended for the quantitative determination of unfractioned heparin (UFH) in purified solutions by measurement of factor Xa inhibition activity.
KRISHZYME™ Heparin Factor IIa Assay Kit KRISHZYME™ Heparin Factor IIa Assay Kit

KRISHZYME™ Heparin Factor IIa Assay Kit

Reference: KBBA03S
€0.00 (tax incl.)
Chromogenic assay for testing Heparins (UFH) in purified systems by measurement of Factor IIa inhibition, in compliance with EP Pharmacopoeia. About the kit: - Uses anti-idiotypic antibodies sourced from our vendor...
D-Glucose-6-phosphate D-Glucose-6-phosphate

D-Glucose-6-phosphate

Reference: F521-59-10 mg
€0.00 (tax incl.)
D-glucose-6-phosphate (sodium salt) is supplied as a crystalline solid.
D-Fructose-6-phosphate D-Fructose-6-phosphate

D-Fructose-6-phosphate

Reference: F520-59-10
€0.00 (tax incl.)
D-Fructose-6-phosphate (sodium salt hydrate) is supplied as a crystalline solid.
PI:PS PI:PS

PI:PS

Reference: P425-59B-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI:PS PI:PS

PI:PS

Reference: P425-59B-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(5)P:PS PI(5)P:PS

PI(5)P:PS

Reference: P428-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(5)P:PS PI(5)P:PS

PI(5)P:PS

Reference: P428-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(5)P PI(5)P

PI(5)P

Reference: P423-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(5)P PI(5)P

PI(5)P

Reference: P423-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4,5)P2:PS PI(4,5)P2:PS

PI(4,5)P2:PS

Reference: P429-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4,5)P2:PS PI(4,5)P2:PS

PI(4,5)P2:PS

Reference: P429-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4,5)P2 PI(4,5)P2

PI(4,5)P2

Reference: P424-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4,5)P2 PI(4,5)P2

PI(4,5)P2

Reference: P424-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4)P:PS PI(4)P:PS

PI(4)P:PS

Reference: P427-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4)P:PS PI(4)P:PS

PI(4)P:PS

Reference: P427-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4)P PI(4)P

PI(4)P

Reference: P422-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4)P PI(4)P

PI(4)P

Reference: P422-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(3)P:PS PI(3)P:PS

PI(3)P:PS

Reference: P426-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(3)P:PS PI(3)P:PS

PI(3)P:PS

Reference: P426-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(3)P PI(3)P

PI(3)P

Reference: P421-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(3)P PI(3)P

PI(3)P

Reference: P421-59-05
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Poly (1:1 dI, dC) Acid Poly (1:1 dI, dC) Acid

Poly (1:1 dI, dC) Acid

Reference: P62-58-25
€0.00 (tax incl.)
The synthetic poly (deoxyinosinic-deoxycytidylic) acid sodium salt – double-stranded polymer (synthesized as 1:1 ratio) is used as a substrate for DNA methyltransferases.
METTL3/METTL14 Substrate METTL3/METTL14 Substrate

METTL3/METTL14 Substrate

Reference: M323-58-025
€0.00 (tax incl.)
The synthetic single-stranded 27 base’s oligo ribo-nucleotide is used as a substrate for assay of methyltransferase METTL3/METTL14 complex.
DNMT Substrate-1 DNMT Substrate-1

DNMT Substrate-1

Reference: D53-58-05
€0.00 (tax incl.)
The synthetic double-stranded oligonucleotide (Sense: 5’- GATCCGACGACGACGCGCGCGCGACGACGAGATC; Anti-sense: 5’- GATCTCGTCGTCGCGCGCGCGTCGTCGTCGGAC) is used as a substrate for DNA methyltransferase 3A (DNMT3A).
DUB Substrate III DUB Substrate III

DUB Substrate III

Reference: N263-57-10
€0.00 (tax incl.)
The NEDD8-based proluciferin substrate is based on the C-terminal derivative of NEDD8.
DUB Substrate II DUB Substrate II

DUB Substrate II

Reference: S293-57-10
€0.00 (tax incl.)
The SUMO1-based proluciferin substrate is based on the C-terminal derivative of SUMO1.
DUB Substrate I DUB Substrate I

DUB Substrate I

Reference: U06-57-10
€0.00 (tax incl.)
The ubiquitin-based proluciferin substrate is based on the C-terminal derivative of Ubiquitin.
Tyrosine Kinase Substrate-3 Tyrosine Kinase Substrate-3

Tyrosine Kinase Substrate-3

Reference: T71-58
€0.00 (tax incl.)
The synthetic peptide Tyrosine Kinase Substrate-3 (RRLIEDAEYAARG) is derived from human SRC (amino acid 412-422) and considered to be a generic substrate for various protein tyrosine kinases.
SRC Substrate SRC Substrate

SRC Substrate

Reference: S30-58
€0.00 (tax incl.)
The SRC sub peptide sequence (KVEKIGEGTYGVVYK-amide) is based on the p34cdc2 (amino acid 6-20).
S6K Substrate S6K Substrate

S6K Substrate

Reference: S05-58
€0.00 (tax incl.)
The S6K sub peptide sequence (KRRRLASLR) is based on human 40S ribosomal protein S6 (amino acid 230-238).
RSK Substrate RSK Substrate

RSK Substrate

Reference: S06-58
€0.00 (tax incl.)
The RSK sub peptide sequence (KRRRLSSLRA) is based on human 40S ribosomal protein S6 (amino acid 230-239).
PP2B Substrate PP2B Substrate

PP2B Substrate

Reference: P51-58-1000
€0.00 (tax incl.)
The PP2B Substrate peptide [DLDVPIPGRFDRRV(p)SVAAE] is derived from bovine PRKAR2A (cAMP-dependent protein kinase type II-alpha regulatory subunit) (amino acids 82-100) and is suitable as PP2B substrate.
PP1/PP2A Substrate PP1/PP2A Substrate

PP1/PP2A Substrate

Reference: P50-58-1000
€0.00 (tax incl.)
The PP1/PP2A Substrate peptide [GRPRTS(p)SFAEG] is derived from human GSK3b (glycogen synthase kinase-3 beta) (amino acids 3-13) and is suitable as PP1 and PP2A substrate.
PLpro FRET Substrate PLpro FRET Substrate

PLpro FRET Substrate

Reference: PL01-58-1000
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for PLpro.
PLpro FRET Substrate PLpro FRET Substrate

PLpro FRET Substrate

Reference: PL01-58-500
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for PLpro.
PKA Substrate PKA Substrate

PKA Substrate

Reference: C01-58
€0.00 (tax incl.)
The PKA sub peptide sequence (CGRTGRRNSI-amide) is based on the cAMP-dependent protein kinase inhibitor alpha (amino acid 15-23).
p38 Substrate p38 Substrate

p38 Substrate

Reference: P03-58
€0.00 (tax incl.)
The synthetic peptide (IPTTPITTTYFFFKKK) contains serine/threonine protein kinase phosphorylation sites and is routinely evaluated as a substrate for p38 family kinases.
Modified PKA Substrate Modified PKA Substrate

Modified PKA Substrate

Reference: C01-58B
€0.00 (tax incl.)
The modified PKA Substrate peptide sequence (modified-CGRTGRRNSI-amide) is based on the cAMP-dependent protein kinase inhibitor alpha (amino acid 15-23).
Modified AXLtide Substrate Modified AXLtide Substrate

Modified AXLtide Substrate

Reference: A16-58B
€0.00 (tax incl.)
The Axltide peptide sequence (CKKSRGDYMTMQIG) is based on the mouse Insulin receptor substrate 1 (amino acid 979-989).
Modified AKT Substrate II Modified AKT Substrate II

Modified AKT Substrate II

Reference: A05-58C
€0.00 (tax incl.)
The Modified AKT Substrate II peptide sequence (modified-CKRPRAASFAE) is based on the N-terminus of GSK3.
Modified AKT Substrate Modified AKT Substrate

Modified AKT Substrate

Reference: A05-58B
€0.00 (tax incl.)
The Modified AKT Substrate peptide sequence (modified-CKRPRAASFAE) is based on the N-terminus of GSK3.
HER2 Substrate HER2 Substrate

HER2 Substrate

Reference: E27-58
€0.00 (tax incl.)
The HER2 Substrate synthetic peptide [AAEEIYAARRG] is routinely evaluated as a substrate for HER2.
GSK3 Substrate GSK3 Substrate

GSK3 Substrate

Reference: G50-58
€0.00 (tax incl.)
The GSK3 sub peptide sequence (YRRAAVPPSPSLSRHSSPHQ(pS)EDEEE) is based on human muscle glycogen synthase 1 (amino acid 636-661).
CK2 Substrate CK2 Substrate

CK2 Substrate

Reference: C08-58
€0.00 (tax incl.)
The synthetic peptide (RRRADDSDDDDD) contains serine protein kinase phosphorylation site surrounded by acidic residues and is high selectively evaluated as a substrate for CK2 family kinases.
AKT (SGK) Substrate AKT (SGK) Substrate

AKT (SGK) Substrate

Reference: A08-58
€0.00 (tax incl.)
The AKT (SGK) Substrate peptide sequence (RPRAATF) is based on the N-terminus of GSK3.
AKT (PKB) Substrate AKT (PKB) Substrate

AKT (PKB) Substrate

Reference: A05-58
€0.00 (tax incl.)
The AKT (PKB) Substrate peptide sequence (CKRPRAASFAE) is based on the N-terminus of GSK3.
3CLpro FRET Substrate 3CLpro FRET Substrate

3CLpro FRET Substrate

Reference: CL01-58-1000
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for 3CLpro.
3CLpro FRET Substrate 3CLpro FRET Substrate

3CLpro FRET Substrate

Reference: CL01-58-500
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for 3CLpro.
PKC Lipid Activator, 10x PKC Lipid Activator, 10x

PKC Lipid Activator, 10x

Reference: L51-39-500
€0.00 (tax incl.)
10x stock solution used for assaying protein kinase activity of PKC family members. Vortex or sonicate prior to use.
Neddylation Buffer Neddylation Buffer

Neddylation Buffer

Reference: N01-09-20
€0.00 (tax incl.)
Stock solution of buffer used for assaying ubiquitin enzymes.
Neddylation Buffer Neddylation Buffer

Neddylation Buffer

Reference: N01-09-05
€0.00 (tax incl.)
Stock solution of buffer used for assaying ubiquitin enzymes.
Neddylation Buffer Neddylation Buffer

Neddylation Buffer

Reference: N01-09-01
€0.00 (tax incl.)
Stock solution of buffer used for assaying ubiquitin enzymes.
MnCl2 Solution MnCl2 Solution

MnCl2 Solution

Reference: M40-09-25
€0.00 (tax incl.)
25μl volume of 2.5M MnCl2 solution for different enzyme assays.

Menu

Settings

Please sign in first.

Sign in