Category: Research kits

Filter By
Brand: Signalchem Clear all
D-Glucose-6-phosphate D-Glucose-6-phosphate

D-Glucose-6-phosphate

Reference: F521-59-10 mg
€0.00 (tax incl.)
D-glucose-6-phosphate (sodium salt) is supplied as a crystalline solid.
D-Fructose-6-phosphate D-Fructose-6-phosphate

D-Fructose-6-phosphate

Reference: F520-59-10
€0.00 (tax incl.)
D-Fructose-6-phosphate (sodium salt hydrate) is supplied as a crystalline solid.
PI:PS PI:PS

PI:PS

Reference: P425-59B-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI:PS PI:PS

PI:PS

Reference: P425-59B-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(5)P:PS PI(5)P:PS

PI(5)P:PS

Reference: P428-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(5)P:PS PI(5)P:PS

PI(5)P:PS

Reference: P428-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(5)P PI(5)P

PI(5)P

Reference: P423-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(5)P PI(5)P

PI(5)P

Reference: P423-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4,5)P2:PS PI(4,5)P2:PS

PI(4,5)P2:PS

Reference: P429-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4,5)P2:PS PI(4,5)P2:PS

PI(4,5)P2:PS

Reference: P429-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4,5)P2 PI(4,5)P2

PI(4,5)P2

Reference: P424-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4,5)P2 PI(4,5)P2

PI(4,5)P2

Reference: P424-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4)P:PS PI(4)P:PS

PI(4)P:PS

Reference: P427-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4)P:PS PI(4)P:PS

PI(4)P:PS

Reference: P427-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4)P PI(4)P

PI(4)P

Reference: P422-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(4)P PI(4)P

PI(4)P

Reference: P422-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(3)P:PS PI(3)P:PS

PI(3)P:PS

Reference: P426-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(3)P:PS PI(3)P:PS

PI(3)P:PS

Reference: P426-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(3)P PI(3)P

PI(3)P

Reference: P421-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
PI(3)P PI(3)P

PI(3)P

Reference: P421-59-05
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Poly (1:1 dI, dC) Acid Poly (1:1 dI, dC) Acid

Poly (1:1 dI, dC) Acid

Reference: P62-58-25
€0.00 (tax incl.)
The synthetic poly (deoxyinosinic-deoxycytidylic) acid sodium salt – double-stranded polymer (synthesized as 1:1 ratio) is used as a substrate for DNA methyltransferases.
METTL3/METTL14 Substrate METTL3/METTL14 Substrate

METTL3/METTL14 Substrate

Reference: M323-58-025
€0.00 (tax incl.)
The synthetic single-stranded 27 base’s oligo ribo-nucleotide is used as a substrate for assay of methyltransferase METTL3/METTL14 complex.
DNMT Substrate-1 DNMT Substrate-1

DNMT Substrate-1

Reference: D53-58-05
€0.00 (tax incl.)
The synthetic double-stranded oligonucleotide (Sense: 5’- GATCCGACGACGACGCGCGCGCGACGACGAGATC; Anti-sense: 5’- GATCTCGTCGTCGCGCGCGCGTCGTCGTCGGAC) is used as a substrate for DNA methyltransferase 3A (DNMT3A).
DUB Substrate III DUB Substrate III

DUB Substrate III

Reference: N263-57-10
€0.00 (tax incl.)
The NEDD8-based proluciferin substrate is based on the C-terminal derivative of NEDD8.
DUB Substrate II DUB Substrate II

DUB Substrate II

Reference: S293-57-10
€0.00 (tax incl.)
The SUMO1-based proluciferin substrate is based on the C-terminal derivative of SUMO1.
DUB Substrate I DUB Substrate I

DUB Substrate I

Reference: U06-57-10
€0.00 (tax incl.)
The ubiquitin-based proluciferin substrate is based on the C-terminal derivative of Ubiquitin.
Tyrosine Kinase Substrate-3 Tyrosine Kinase Substrate-3

Tyrosine Kinase Substrate-3

Reference: T71-58
€0.00 (tax incl.)
The synthetic peptide Tyrosine Kinase Substrate-3 (RRLIEDAEYAARG) is derived from human SRC (amino acid 412-422) and considered to be a generic substrate for various protein tyrosine kinases.
SRC Substrate SRC Substrate

SRC Substrate

Reference: S30-58
€0.00 (tax incl.)
The SRC sub peptide sequence (KVEKIGEGTYGVVYK-amide) is based on the p34cdc2 (amino acid 6-20).
S6K Substrate S6K Substrate

S6K Substrate

Reference: S05-58
€0.00 (tax incl.)
The S6K sub peptide sequence (KRRRLASLR) is based on human 40S ribosomal protein S6 (amino acid 230-238).
RSK Substrate RSK Substrate

RSK Substrate

Reference: S06-58
€0.00 (tax incl.)
The RSK sub peptide sequence (KRRRLSSLRA) is based on human 40S ribosomal protein S6 (amino acid 230-239).
PP2B Substrate PP2B Substrate

PP2B Substrate

Reference: P51-58-1000
€0.00 (tax incl.)
The PP2B Substrate peptide [DLDVPIPGRFDRRV(p)SVAAE] is derived from bovine PRKAR2A (cAMP-dependent protein kinase type II-alpha regulatory subunit) (amino acids 82-100) and is suitable as PP2B substrate.
PP1/PP2A Substrate PP1/PP2A Substrate

PP1/PP2A Substrate

Reference: P50-58-1000
€0.00 (tax incl.)
The PP1/PP2A Substrate peptide [GRPRTS(p)SFAEG] is derived from human GSK3b (glycogen synthase kinase-3 beta) (amino acids 3-13) and is suitable as PP1 and PP2A substrate.
PLpro FRET Substrate PLpro FRET Substrate

PLpro FRET Substrate

Reference: PL01-58-1000
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for PLpro.
PLpro FRET Substrate PLpro FRET Substrate

PLpro FRET Substrate

Reference: PL01-58-500
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for PLpro.
PKA Substrate PKA Substrate

PKA Substrate

Reference: C01-58
€0.00 (tax incl.)
The PKA sub peptide sequence (CGRTGRRNSI-amide) is based on the cAMP-dependent protein kinase inhibitor alpha (amino acid 15-23).
p38 Substrate p38 Substrate

p38 Substrate

Reference: P03-58
€0.00 (tax incl.)
The synthetic peptide (IPTTPITTTYFFFKKK) contains serine/threonine protein kinase phosphorylation sites and is routinely evaluated as a substrate for p38 family kinases.
Modified PKA Substrate Modified PKA Substrate

Modified PKA Substrate

Reference: C01-58B
€0.00 (tax incl.)
The modified PKA Substrate peptide sequence (modified-CGRTGRRNSI-amide) is based on the cAMP-dependent protein kinase inhibitor alpha (amino acid 15-23).
Modified AXLtide Substrate Modified AXLtide Substrate

Modified AXLtide Substrate

Reference: A16-58B
€0.00 (tax incl.)
The Axltide peptide sequence (CKKSRGDYMTMQIG) is based on the mouse Insulin receptor substrate 1 (amino acid 979-989).
Modified AKT Substrate II Modified AKT Substrate II

Modified AKT Substrate II

Reference: A05-58C
€0.00 (tax incl.)
The Modified AKT Substrate II peptide sequence (modified-CKRPRAASFAE) is based on the N-terminus of GSK3.
Modified AKT Substrate Modified AKT Substrate

Modified AKT Substrate

Reference: A05-58B
€0.00 (tax incl.)
The Modified AKT Substrate peptide sequence (modified-CKRPRAASFAE) is based on the N-terminus of GSK3.
HER2 Substrate HER2 Substrate

HER2 Substrate

Reference: E27-58
€0.00 (tax incl.)
The HER2 Substrate synthetic peptide [AAEEIYAARRG] is routinely evaluated as a substrate for HER2.
GSK3 Substrate GSK3 Substrate

GSK3 Substrate

Reference: G50-58
€0.00 (tax incl.)
The GSK3 sub peptide sequence (YRRAAVPPSPSLSRHSSPHQ(pS)EDEEE) is based on human muscle glycogen synthase 1 (amino acid 636-661).
CK2 Substrate CK2 Substrate

CK2 Substrate

Reference: C08-58
€0.00 (tax incl.)
The synthetic peptide (RRRADDSDDDDD) contains serine protein kinase phosphorylation site surrounded by acidic residues and is high selectively evaluated as a substrate for CK2 family kinases.
AKT (SGK) Substrate AKT (SGK) Substrate

AKT (SGK) Substrate

Reference: A08-58
€0.00 (tax incl.)
The AKT (SGK) Substrate peptide sequence (RPRAATF) is based on the N-terminus of GSK3.
AKT (PKB) Substrate AKT (PKB) Substrate

AKT (PKB) Substrate

Reference: A05-58
€0.00 (tax incl.)
The AKT (PKB) Substrate peptide sequence (CKRPRAASFAE) is based on the N-terminus of GSK3.
3CLpro FRET Substrate 3CLpro FRET Substrate

3CLpro FRET Substrate

Reference: CL01-58-1000
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for 3CLpro.
3CLpro FRET Substrate 3CLpro FRET Substrate

3CLpro FRET Substrate

Reference: CL01-58-500
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for 3CLpro.
PKC Lipid Activator, 10x PKC Lipid Activator, 10x

PKC Lipid Activator, 10x

Reference: L51-39-500
€0.00 (tax incl.)
10x stock solution used for assaying protein kinase activity of PKC family members. Vortex or sonicate prior to use.
Neddylation Buffer Neddylation Buffer

Neddylation Buffer

Reference: N01-09-20
€0.00 (tax incl.)
Stock solution of buffer used for assaying ubiquitin enzymes.
Neddylation Buffer Neddylation Buffer

Neddylation Buffer

Reference: N01-09-05
€0.00 (tax incl.)
Stock solution of buffer used for assaying ubiquitin enzymes.
Neddylation Buffer Neddylation Buffer

Neddylation Buffer

Reference: N01-09-01
€0.00 (tax incl.)
Stock solution of buffer used for assaying ubiquitin enzymes.
MnCl2 Solution MnCl2 Solution

MnCl2 Solution

Reference: M40-09-25
€0.00 (tax incl.)
25μl volume of 2.5M MnCl2 solution for different enzyme assays.
Lipid Kinase Buffer Lipid Kinase Buffer

Lipid Kinase Buffer

Reference: L01-09-20
€0.00 (tax incl.)
The 5x stock solution of buffer used for assaying lipid kinase proteins.
Lipid Kinase Buffer Lipid Kinase Buffer

Lipid Kinase Buffer

Reference: L01-09-05
€0.00 (tax incl.)
The 5x stock solution of buffer used for assaying lipid kinase proteins.
Lipid Kinase Buffer Lipid Kinase Buffer

Lipid Kinase Buffer

Reference: L01-09-01
€0.00 (tax incl.)
The 5x stock solution of buffer used for assaying lipid kinase proteins.
Lipid Dilution Buffer Lipid Dilution Buffer

Lipid Dilution Buffer

Reference: L21-09-20
€0.00 (tax incl.)
The working solution used for diluting lipid substrates.
Lipid Dilution Buffer Lipid Dilution Buffer

Lipid Dilution Buffer

Reference: L21-09-05
€0.00 (tax incl.)
The working solution used for diluting lipid substrates.

Menu

Settings

Please sign in first.

Sign in