Category: Research kits

Reference: D53-58-05
€0.00 (tax incl.)
The synthetic double-stranded oligonucleotide (Sense: 5’- GATCCGACGACGACGCGCGCGCGACGACGAGATC; Anti-sense: 5’- GATCTCGTCGTCGCGCGCGCGTCGTCGTCGGAC) is used as a substrate for DNA methyltransferase 3A (DNMT3A).
Reference: M323-58-025
€0.00 (tax incl.)
The synthetic single-stranded 27 base’s oligo ribo-nucleotide is used as a substrate for assay of methyltransferase METTL3/METTL14 complex.
Reference: P62-58-25
€0.00 (tax incl.)
The synthetic poly (deoxyinosinic-deoxycytidylic) acid sodium salt – double-stranded polymer (synthesized as 1:1 ratio) is used as a substrate for DNA methyltransferases.
Reference: P421-59-05
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P421-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P426-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P426-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P422-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P422-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P427-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P427-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P424-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P424-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P429-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P429-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P423-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P423-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P428-59-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P428-59-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P425-59B-500
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: P425-59B-1000
€0.00 (tax incl.)
The substrate solution used for assaying lipid kinases.
Reference: F520-59-10
€0.00 (tax incl.)
D-Fructose-6-phosphate (sodium salt hydrate) is supplied as a crystalline solid.
Reference: F521-59-10 mg
€0.00 (tax incl.)
D-glucose-6-phosphate (sodium salt) is supplied as a crystalline solid.
Reference: ABK-001-2L
€0.00 (tax incl.)
The chemiluminescence substrate solution is a simple triggering reagent for acridinium ester (AE) fast light emission. Acridinium ester is the most commonly used for protein labeling and widely used in automated...
Reference: DB-02-50ml
€0.00 (tax incl.)
Serum and some samples often cause nonspecific binding,especially after blocking,which lead to high background and low sensitivity.
Reference: DB-02-500ml
€0.00 (tax incl.)
Serum and some samples often cause nonspecific binding,especially after blocking,which lead to high background and low sensitivity.
Reference: ABK-002-200ml
€0.00 (tax incl.)
The Chemiluminescent Substrate Solution (HRP Marker) is a specific triggering reagent for peroxidase labels such as horseradish peroxidase (HRP) and can be used in ELISA procedures. This substrate is an enhanced...
Reference: CEB-C301-50ml
€0.00 (tax incl.)
ELISA Washing Buffer is a PBS-based wash buffer for use in sandwich ELISA procedures. The buffer is the same formulation that is supplied with most ClinMax™ ELISA kits for cytokines and biomarkers, but not all. The...

Menu

Settings