Category: Research kits

Filter By
Brand: ACROBiosystems  Brand: Signalchem Clear all
3CLpro FRET Substrate 3CLpro FRET Substrate

3CLpro FRET Substrate

Reference: CL01-58-1000
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for 3CLpro.
3CLpro FRET Substrate 3CLpro FRET Substrate

3CLpro FRET Substrate

Reference: CL01-58-500
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for 3CLpro.
AAV Capsid Titration Detection Antibody Pair (Universal) AAV Capsid Titration Detection Antibody Pair (Universal)

AAV Capsid Titration Detection Antibody Pair (Universal)

Reference: AAVX-01-960tests
€0.00 (tax incl.)
Adeno-associated virus (AAV) is the simplest and non-enveloped single-stranded DNA virus with a viral genome length of about 4.7Kb, which belongs to the parvovirus family. AAV has become one of the most important...
Acetyltransferase Assay Buffer Acetyltransferase Assay Buffer

Acetyltransferase Assay Buffer

Reference: A01-09-20
€0.00 (tax incl.)
5X stock solution of the buffer used for assaying histone acetyltransferases (KAT).
Acetyltransferase Assay Buffer Acetyltransferase Assay Buffer

Acetyltransferase Assay Buffer

Reference: A01-09-05
€0.00 (tax incl.)
5X stock solution of the buffer used for assaying histone acetyltransferases (KAT).
Acetyltransferase Assay Buffer Acetyltransferase Assay Buffer

Acetyltransferase Assay Buffer

Reference: A01-09-01
€0.00 (tax incl.)
5X stock solution of the buffer used for assaying histone acetyltransferases (KAT).
AGLink® ADC Conjugation Kit (MMAE, DAR2&DAR4, 2mg) AGLink® ADC Conjugation Kit (MMAE, DAR2&DAR4, 2mg)

AGLink® ADC Conjugation Kit (MMAE, DAR2&DAR4, 2mg)

Reference: ADC-P002-1Reaction
€0.00 (tax incl.)
Antibody-drug conjugates (ADC) is a type of fast growing anticancer drug. Monoclonal antibody is conjugated to the cytotoxic payload via a chemical linker that directed toward a target antigen expressed on the cancer...
AGLink® ADC Conjugation Kit (MMAE, DAR2&DAR4, 5mg) AGLink® ADC Conjugation Kit (MMAE, DAR2&DAR4, 5mg)

AGLink® ADC Conjugation Kit (MMAE, DAR2&DAR4, 5mg)

Reference: ADC-P004-1Reaction
€0.00 (tax incl.)
Antibody-drug conjugates (ADC) is a type of fast growing anticancer drug. Monoclonal antibody is conjugated to the cytotoxic payload via a chemical linker that directed toward a target antigen expressed on the cancer...
AGLink® ADC Conjugation Kit (MMAE, DAR4, 2mg) AGLink® ADC Conjugation Kit (MMAE, DAR4, 2mg)

AGLink® ADC Conjugation Kit (MMAE, DAR4, 2mg)

Reference: ADC-P001-1Reaction
€0.00 (tax incl.)
Antibody-drug conjugates (ADC) is a type of fast growing anticancer drug. Monoclonal antibody is conjugated to the cytotoxic payload via a chemical linker that directed toward a target antigen expressed on the cancer...
AGLink® ADC Conjugation Kit (MMAE, DAR4, 5mg) AGLink® ADC Conjugation Kit (MMAE, DAR4, 5mg)

AGLink® ADC Conjugation Kit (MMAE, DAR4, 5mg)

Reference: ADC-P003-1Reaction
€0.00 (tax incl.)
Antibody-drug conjugates (ADC) is a type of fast growing anticancer drug. Monoclonal antibody is conjugated to the cytotoxic payload via a chemical linker that directed toward a target antigen expressed on the cancer...
AKT (PKB) Substrate AKT (PKB) Substrate

AKT (PKB) Substrate

Reference: A05-58
€0.00 (tax incl.)
The AKT (PKB) Substrate peptide sequence (CKRPRAASFAE) is based on the N-terminus of GSK3.
AKT (SGK) Substrate AKT (SGK) Substrate

AKT (SGK) Substrate

Reference: A08-58
€0.00 (tax incl.)
The AKT (SGK) Substrate peptide sequence (RPRAATF) is based on the N-terminus of GSK3.
AMP Solution AMP Solution

AMP Solution

Reference: A46-09-500
€0.00 (tax incl.)
0.5mM AMP solution used for AMPK family kinase assays.
Anti-HBcAg Antibody IgG Pair Anti-HBcAg Antibody IgG Pair

Anti-HBcAg Antibody IgG Pair

Reference: RAS-P165-100ug
€0.00 (tax incl.)
Hepatitis B core antigen (HBcAg) is a single polypeptide with a molecular weight of 18848u. HBcAg plays an important role in HBV infection. It can reflect the presence of Dane particles in serum and the replication of...
Anti-RSV-Pre-F0 specific Antibody IgG Pair Anti-RSV-Pre-F0 specific Antibody IgG Pair

Anti-RSV-Pre-F0 specific Antibody IgG Pair

Reference: RAS-P166-100ug
€0.00 (tax incl.)
Respiratory syncytial virus (RSV) is a highly contagious virus causing severe infection in infants and the elderly. Various approaches are being used to develop an effective RSV vaccine. The RSV fusion (F) subunit,...
Anti-SARS-CoV-2 Antibody IgG Titer Serologic Assay Kit (Spike RBD) Anti-SARS-CoV-2 Antibody IgG Titer Serologic Assay Kit (Spike RBD)

Anti-SARS-CoV-2 Antibody IgG Titer Serologic Assay Kit (Spike RBD)

Reference: RAS-T024-96tests
€0.00 (tax incl.)
The newly identified Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) has posed a serious threat to human health. A rapid and effective Assay kit detecting the levels of anti-SARS-CoV-2 in human serum can...
Anti-SARS-CoV-2 Antibody IgM Titer Serologic Assay Kit (Spike RBD) Anti-SARS-CoV-2 Antibody IgM Titer Serologic Assay Kit (Spike RBD)

Anti-SARS-CoV-2 Antibody IgM Titer Serologic Assay Kit (Spike RBD)

Reference: RAS-T052-96tests
€0.00 (tax incl.)
The newly identified Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) has posed a serious threat to human health. A rapid and effective assay kit detecting the levels of anti-SARS-CoV-2 in human serum can...
Anti-SARS-CoV-2 Antibody IgM Titer Serologic Assay Kit (Spike S1) Anti-SARS-CoV-2 Antibody IgM Titer Serologic Assay Kit (Spike S1)

Anti-SARS-CoV-2 Antibody IgM Titer Serologic Assay Kit (Spike S1)

Reference: RAS-T051-96tests
€0.00 (tax incl.)
The newly identified Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) has posed a serious threat to human health. A rapid and effective assay kit detecting the levels of anti-SARS-CoV-2 in human serum can...
Anti-SARS-CoV-2 Antibody IgG1 Titer Serologic Assay Kit Anti-SARS-CoV-2 Antibody IgG1 Titer Serologic Assay Kit

Anti-SARS-CoV-2 Antibody IgG1 Titer Serologic Assay Kit

Reference: RAS-T014-96tests
€0.00 (tax incl.)
It's been reported that coronavirus can infect the human respiratory epithelial cells through interaction with the human ACE2 receptor. The spike protein is a large type I transmembrane protein containing two...
Anti-SARS-CoV-2 Antibody IgG2 Titer Serologic Assay Kit Anti-SARS-CoV-2 Antibody IgG2 Titer Serologic Assay Kit

Anti-SARS-CoV-2 Antibody IgG2 Titer Serologic Assay Kit

Reference: RAS-T015-96tests
€0.00 (tax incl.)
It's been reported that coronavirus can infect the human respiratory epithelial cells through interaction with the human ACE2 receptor. The spike protein is a large type I transmembrane protein containing two...
Anti-SARS-CoV-2 Antibody IgG3 Titer Serologic Assay Kit Anti-SARS-CoV-2 Antibody IgG3 Titer Serologic Assay Kit

Anti-SARS-CoV-2 Antibody IgG3 Titer Serologic Assay Kit

Reference: RAS-T016-96tests
€0.00 (tax incl.)
It's been reported that coronavirus can infect the human respiratory epithelial cells through interaction with the human ACE2 receptor. The spike protein is a large type I transmembrane protein containing two...
Anti-SARS-CoV-2 Antibody IgG4 Titer Serologic Assay Kit Anti-SARS-CoV-2 Antibody IgG4 Titer Serologic Assay Kit

Anti-SARS-CoV-2 Antibody IgG4 Titer Serologic Assay Kit

Reference: RAS-T017-96tests
€0.00 (tax incl.)
It's been reported that coronavirus can infect the human respiratory epithelial cells through interaction with the human ACE2 receptor. The spike protein is a large type I transmembrane protein containing two...
ATP Stock Solution ATP Stock Solution

ATP Stock Solution

Reference: A50-09-200
€0.00 (tax incl.)
10 mM ATP Stock Solution used for preparing hot ATP assay cocktail.
C-MET IHC 1A1 Kit C-MET IHC 1A1 Kit

C-MET IHC 1A1 Kit

Reference: CAA-B003-30ml
€0.00 (tax incl.)
C-MET IHC 1A1 Kit is expressed from Rabbit
C-MET IHC 1A1 Kit C-MET IHC 1A1 Kit

C-MET IHC 1A1 Kit

Reference: CAA-B003-7.5ml
€0.00 (tax incl.)
C-MET IHC 1A1 Kit is expressed from Rabbit
C-MET IHC 1A1 Kit C-MET IHC 1A1 Kit

C-MET IHC 1A1 Kit

Reference: CAA-B003-2ml
€0.00 (tax incl.)
C-MET IHC 1A1 Kit is expressed from Rabbit
Ca2+/Calmodulin Solution II, 10x Ca2+/Calmodulin Solution II, 10x

Ca2+/Calmodulin Solution II, 10x

Reference: C02-39B-500
€0.00 (tax incl.)
10x stock solution used for assaying activity of calcium-calmodulin-activated protein kinase enzymes.
CaCl2 Solution CaCl2 Solution

CaCl2 Solution

Reference: C02-09-25
€0.00 (tax incl.)
25 μl volume of 1 M CaCl2 solution for different enzyme assays.
cAMP Solution cAMP Solution

cAMP Solution

Reference: A47-09-500
€0.00 (tax incl.)
500ul volume of 100uM cAMP solution for different enzyme assays.
CD73 Inhibitor Screening Kit CD73 Inhibitor Screening Kit

CD73 Inhibitor Screening Kit

Reference: EP-166-96tests
€0.00 (tax incl.)
5'-nucleotidase (5'-NT), also known as ecto-5'-nucleotidase or CD73 (cluster of differentiation 73), is an enzyme that is encoded by the NT5E gene. CD73 commonly serves to convert AMP to adenosine....
cGMP Solution cGMP Solution

cGMP Solution

Reference: G47-09-500
€0.00 (tax incl.)
500ul volume of 100uM cGMP solution for different enzyme assays.
Chemiluminescent Substrate Solution (AE Marker) Chemiluminescent Substrate Solution (AE Marker)

Chemiluminescent Substrate Solution (AE Marker)

Reference: ABK-001-2L
€0.00 (tax incl.)
The chemiluminescence substrate solution is a simple triggering reagent for acridinium ester (AE) fast light emission. Acridinium ester is the most commonly used for protein labeling and widely used in automated...
Chemiluminescent Substrate Solution (HRP Marker) Chemiluminescent Substrate Solution (HRP Marker)

Chemiluminescent Substrate Solution (HRP Marker)

Reference: ABK-002-200ml
€0.00 (tax incl.)
The Chemiluminescent Substrate Solution (HRP Marker) is a specific triggering reagent for peroxidase labels such as horseradish peroxidase (HRP) and can be used in ELISA procedures. This substrate is an enhanced...
CK2 Substrate CK2 Substrate

CK2 Substrate

Reference: C08-58
€0.00 (tax incl.)
The synthetic peptide (RRRADDSDDDDD) contains serine protein kinase phosphorylation site surrounded by acidic residues and is high selectively evaluated as a substrate for CK2 family kinases.
D-Fructose-6-phosphate D-Fructose-6-phosphate

D-Fructose-6-phosphate

Reference: F520-59-10
€0.00 (tax incl.)
D-Fructose-6-phosphate (sodium salt hydrate) is supplied as a crystalline solid.
D-Glucose-6-phosphate D-Glucose-6-phosphate

D-Glucose-6-phosphate

Reference: F521-59-10 mg
€0.00 (tax incl.)
D-glucose-6-phosphate (sodium salt) is supplied as a crystalline solid.
Dilution Buffer (Strengthen Blocking) Dilution Buffer (Strengthen Blocking)

Dilution Buffer (Strengthen Blocking)

Reference: DB-02-500ml
€0.00 (tax incl.)
Serum and some samples often cause nonspecific binding,especially after blocking,which lead to high background and low sensitivity.
Dilution Buffer (Strengthen Blocking) Dilution Buffer (Strengthen Blocking)

Dilution Buffer (Strengthen Blocking)

Reference: DB-02-50ml
€0.00 (tax incl.)
Serum and some samples often cause nonspecific binding,especially after blocking,which lead to high background and low sensitivity.
DNMT Substrate-1 DNMT Substrate-1

DNMT Substrate-1

Reference: D53-58-05
€0.00 (tax incl.)
The synthetic double-stranded oligonucleotide (Sense: 5’- GATCCGACGACGACGCGCGCGCGACGACGAGATC; Anti-sense: 5’- GATCTCGTCGTCGCGCGCGCGTCGTCGTCGGAC) is used as a substrate for DNA methyltransferase 3A (DNMT3A).
DTT Solution DTT Solution

DTT Solution

Reference: D86-09B-10
€0.00 (tax incl.)
0.1 M DTT solution used for preparing protein kinase assay buffer.
DTT Solution DTT Solution

DTT Solution

Reference: D86-09-10
€0.00 (tax incl.)
1 M DTT solution used for preparing protein kinase assay buffer.

Menu

Settings

Please sign in first.

Sign in