Category: Research kits

Filter By
Brand: Indigo Brand: Signalchem Clear all
3CLpro FRET Substrate 3CLpro FRET Substrate

3CLpro FRET Substrate

Reference: CL01-58-1000
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for 3CLpro.
3CLpro FRET Substrate 3CLpro FRET Substrate

3CLpro FRET Substrate

Reference: CL01-58-500
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for 3CLpro.
Acetyltransferase Assay Buffer Acetyltransferase Assay Buffer

Acetyltransferase Assay Buffer

Reference: A01-09-20
€0.00 (tax incl.)
5X stock solution of the buffer used for assaying histone acetyltransferases (KAT).
Acetyltransferase Assay Buffer Acetyltransferase Assay Buffer

Acetyltransferase Assay Buffer

Reference: A01-09-05
€0.00 (tax incl.)
5X stock solution of the buffer used for assaying histone acetyltransferases (KAT).
Acetyltransferase Assay Buffer Acetyltransferase Assay Buffer

Acetyltransferase Assay Buffer

Reference: A01-09-01
€0.00 (tax incl.)
5X stock solution of the buffer used for assaying histone acetyltransferases (KAT).
AKT (PKB) Substrate AKT (PKB) Substrate

AKT (PKB) Substrate

Reference: A05-58
€0.00 (tax incl.)
The AKT (PKB) Substrate peptide sequence (CKRPRAASFAE) is based on the N-terminus of GSK3.
AKT (SGK) Substrate AKT (SGK) Substrate

AKT (SGK) Substrate

Reference: A08-58
€0.00 (tax incl.)
The AKT (SGK) Substrate peptide sequence (RPRAATF) is based on the N-terminus of GSK3.
AMP Solution AMP Solution

AMP Solution

Reference: A46-09-500
€0.00 (tax incl.)
0.5mM AMP solution used for AMPK family kinase assays.
ATP Stock Solution ATP Stock Solution

ATP Stock Solution

Reference: A50-09-200
€0.00 (tax incl.)
10 mM ATP Stock Solution used for preparing hot ATP assay cocktail.
Ca2+/Calmodulin Solution II, 10x Ca2+/Calmodulin Solution II, 10x

Ca2+/Calmodulin Solution II, 10x

Reference: C02-39B-500
€0.00 (tax incl.)
10x stock solution used for assaying activity of calcium-calmodulin-activated protein kinase enzymes.
CaCl2 Solution CaCl2 Solution

CaCl2 Solution

Reference: C02-09-25
€0.00 (tax incl.)
25 μl volume of 1 M CaCl2 solution for different enzyme assays.
cAMP Solution cAMP Solution

cAMP Solution

Reference: A47-09-500
€0.00 (tax incl.)
500ul volume of 100uM cAMP solution for different enzyme assays.
cGMP Solution cGMP Solution

cGMP Solution

Reference: G47-09-500
€0.00 (tax incl.)
500ul volume of 100uM cGMP solution for different enzyme assays.
CK2 Substrate CK2 Substrate

CK2 Substrate

Reference: C08-58
€0.00 (tax incl.)
The synthetic peptide (RRRADDSDDDDD) contains serine protein kinase phosphorylation site surrounded by acidic residues and is high selectively evaluated as a substrate for CK2 family kinases.
D-Fructose-6-phosphate D-Fructose-6-phosphate

D-Fructose-6-phosphate

Reference: F520-59-10
€0.00 (tax incl.)
D-Fructose-6-phosphate (sodium salt hydrate) is supplied as a crystalline solid.
D-Glucose-6-phosphate D-Glucose-6-phosphate

D-Glucose-6-phosphate

Reference: F521-59-10 mg
€0.00 (tax incl.)
D-glucose-6-phosphate (sodium salt) is supplied as a crystalline solid.
DNMT Substrate-1 DNMT Substrate-1

DNMT Substrate-1

Reference: D53-58-05
€0.00 (tax incl.)
The synthetic double-stranded oligonucleotide (Sense: 5’- GATCCGACGACGACGCGCGCGCGACGACGAGATC; Anti-sense: 5’- GATCTCGTCGTCGCGCGCGCGTCGTCGTCGGAC) is used as a substrate for DNA methyltransferase 3A (DNMT3A).
DTT Solution DTT Solution

DTT Solution

Reference: D86-09B-10
€0.00 (tax incl.)
0.1 M DTT solution used for preparing protein kinase assay buffer.
DTT Solution DTT Solution

DTT Solution

Reference: D86-09-10
€0.00 (tax incl.)
1 M DTT solution used for preparing protein kinase assay buffer.
DUB Substrate I DUB Substrate I

DUB Substrate I

Reference: U06-57-10
€0.00 (tax incl.)
The ubiquitin-based proluciferin substrate is based on the C-terminal derivative of Ubiquitin.
DUB Substrate II DUB Substrate II

DUB Substrate II

Reference: S293-57-10
€0.00 (tax incl.)
The SUMO1-based proluciferin substrate is based on the C-terminal derivative of SUMO1.
DUB Substrate III DUB Substrate III

DUB Substrate III

Reference: N263-57-10
€0.00 (tax incl.)
The NEDD8-based proluciferin substrate is based on the C-terminal derivative of NEDD8.

Menu

Settings

Please sign in first.

Sign in