Research kits

The synthetic peptide (RRRADDSDDDDD) contains serine protein kinase phosphorylation site surrounded by acidic residues and is high selectively evaluated as a substrate for CK2 family kinases.

D-Fructose-6-phosphate

Reference: F520-59-10

€0.00 (tax incl.)

D-Fructose-6-phosphate (sodium salt hydrate) is supplied as a crystalline solid.

D-Glucose-6-phosphate

Reference: F521-59-10 mg

€0.00 (tax incl.)

D-glucose-6-phosphate (sodium salt) is supplied as a crystalline solid.

DLG (Dilauroyl-sn-glycerol)

Reference: D430-59-500

€0.00 (tax incl.)

The substrate solution used for assaying Diacylglycerol kinases.

DLG (Dilauroyl-sn-glycerol)

Reference: D430-59-200

€0.00 (tax incl.)

The substrate solution used for assaying Diacylglycerol kinases.

The synthetic double-stranded oligonucleotide (Sense: 5’- GATCCGACGACGACGCGCGCGCGACGACGAGATC; Anti-sense: 5’- GATCTCGTCGTCGCGCGCGCGTCGTCGTCGGAC) is used as a substrate for DNA methyltransferase 3A (DNMT3A).

DTT Solution

Reference: D86-09B-10

€0.00 (tax incl.)

0.1 M DTT solution used for preparing protein kinase assay buffer.

DTT Solution

Reference: D86-09-10

€0.00 (tax incl.)

1 M DTT solution used for preparing protein kinase assay buffer.

DUB Reaction Buffer (4X)

Reference: D01-09-015

€0.00 (tax incl.)

The working solution used for diluting DUBs.

DUB Substrate I

Reference: U06-57-10

€0.00 (tax incl.)

The ubiquitin-based proluciferin substrate is based on the C-terminal derivative of Ubiquitin.

DUB Substrate II

Reference: S293-57-10

€0.00 (tax incl.)

The SUMO1-based proluciferin substrate is based on the C-terminal derivative of SUMO1.

DUB Substrate III

Reference: N263-57-10

€0.00 (tax incl.)

The NEDD8-based proluciferin substrate is based on the C-terminal derivative of NEDD8.

Fructose Kinase Assay Buffer I

Reference: F01-09-20

€0.00 (tax incl.)

Stock solution of buffer used for assaying fructose kinase enzymes.

Fructose Kinase Assay Buffer I

Reference: F01-09-05

€0.00 (tax incl.)

Stock solution of buffer used for assaying fructose kinase enzymes.

Fructose Kinase Assay Buffer I

Reference: F01-09-01

€0.00 (tax incl.)

Stock solution of buffer used for assaying fructose kinase enzymes.

Fructose Kinase Dilution Buffer I

Reference: F21-09-20

€0.00 (tax incl.)

The working solution used for diluting fructose kinase enzymes.

Fructose Kinase Dilution Buffer I

Reference: F21-09-05

€0.00 (tax incl.)

The working solution used for diluting fructose kinase enzymes.

Fructose Kinase Dilution Buffer I

Reference: F21-09-01

€0.00 (tax incl.)

The working solution used for diluting fructose kinase enzymes.

GSK3 Substrate

Reference: G50-58

€0.00 (tax incl.)

The GSK3 sub peptide sequence (YRRAAVPPSPSLSRHSSPHQ(pS)EDEEE) is based on human muscle glycogen synthase 1 (amino acid 636-661).

GTP Solution

Reference: G50-09-500

€0.00 (tax incl.)

500ul volume of 5uM GTP solution for different enzyme assays.

GTP Solution II

Reference: G50-09B-100

€0.00 (tax incl.)

100μl volume of 5mM GTP solution for different enzyme assays.

HER2 Substrate

Reference: E27-58

€0.00 (tax incl.)

The HER2 Substrate synthetic peptide [AAEEIYAARRG] is routinely evaluated as a substrate for HER2.

Kinase Assay Buffer I

Reference: K01-09-20

€0.00 (tax incl.)

Stock solution of buffer used for assaying kinase protein.

Kinase Assay Buffer I

Reference: K01-09-05

€0.00 (tax incl.)

Stock solution of buffer used for assaying kinase protein.

Kinase Assay Buffer I

Reference: K01-09-01

€0.00 (tax incl.)

Stock solution of buffer used for assaying kinase protein.

Kinase Assay Buffer II

Reference: K02-09-20

€0.00 (tax incl.)

Stock solution of buffer used for assaying kinase protein.

Kinase Assay Buffer II

Reference: K02-09-05

€0.00 (tax incl.)

Stock solution of buffer used for assaying kinase protein.

Kinase Assay Buffer II

Reference: K02-09-01

€0.00 (tax incl.)

Stock solution of buffer used for assaying kinase protein.

Kinase Assay Buffer III

Reference: K03-09-20

€0.00 (tax incl.)

The 5x stock solution used for assaying kinase proteins.

Kinase Assay Buffer III

Reference: K03-09-05

€0.00 (tax incl.)

The 5x stock solution used for assaying kinase proteins.

Kinase Assay Buffer III

Reference: K03-09-01

€0.00 (tax incl.)

The 5x stock solution used for assaying kinase proteins.

Kinase Dilution Buffer I

Reference: K21-09-20

€0.00 (tax incl.)

Solution of buffer used for diluting kinase protein.

Kinase Dilution Buffer I

Reference: K21-09-05

€0.00 (tax incl.)

Solution of buffer used for diluting kinase protein.

Kinase Dilution Buffer I

Reference: K21-09-01

€0.00 (tax incl.)

Solution of buffer used for diluting kinase protein.

Kinase Dilution Buffer II

Reference: K22-09-20

€0.00 (tax incl.)

Solution of buffer used for diluting kinase protein.

Kinase Dilution Buffer II

Reference: K22-09-05

€0.00 (tax incl.)

Solution of buffer used for diluting kinase protein.

Kinase Dilution Buffer II

Reference: K22-09-01

€0.00 (tax incl.)

Solution of buffer used for diluting kinase protein.

Kinase Dilution Buffer III

Reference: K23-09-20

€0.00 (tax incl.)

Solution of buffer used for diluting kinase protein.

Kinase Dilution Buffer III

Reference: K23-09-05

€0.00 (tax incl.)

Solution of buffer used for diluting kinase protein.

Kinase Dilution Buffer III

Reference: K23-09-01

€0.00 (tax incl.)

Solution of buffer used for diluting kinase protein.

Kinase Dilution Buffer IV

Reference: K24-09-20

€0.00 (tax incl.)

Solution of buffer used for diluting kinase protein.

Kinase Dilution Buffer IV

Reference: K24-09-05

€0.00 (tax incl.)

Solution of buffer used for diluting kinase protein.

Kinase Dilution Buffer IV

Reference: K24-09-01

€0.00 (tax incl.)

Solution of buffer used for diluting kinase protein.

Kinase Dilution Buffer IX

Reference: K29-09-20

€0.00 (tax incl.)

The working solution used for diluting kinase proteins.

Kinase Dilution Buffer IX

Reference: K29-09-05

€0.00 (tax incl.)

The working solution used for diluting kinase proteins.

Kinase Dilution Buffer IX

Reference: K29-09-01

€0.00 (tax incl.)

The working solution used for diluting kinase proteins.

Kinase Dilution Buffer V

Reference: K25-09-20

€0.00 (tax incl.)

Solution of buffer used for diluting kinase protein.

Kinase Dilution Buffer V

Reference: K25-09-05

€0.00 (tax incl.)

Solution of buffer used for diluting kinase protein.

Kinase Dilution Buffer V

Reference: K25-09-01

€0.00 (tax incl.)

Solution of buffer used for diluting kinase protein.

Kinase Dilution Buffer VI

Reference: K26-09-20

€0.00 (tax incl.)

Solution of buffer used for diluting kinase protein.

Kinase Dilution Buffer VI

Reference: K26-09-05

€0.00 (tax incl.)

Solution of buffer used for diluting kinase protein.

Kinase Dilution Buffer VI

Reference: K26-09-01

€0.00 (tax incl.)

Solution of buffer used for diluting kinase protein.

Kinase Dilution Buffer VII

Reference: K27-09-20

€0.00 (tax incl.)

Solution of buffer used for diluting kinase protein.

Kinase Dilution Buffer VII

Reference: K27-09-05

€0.00 (tax incl.)

Solution of buffer used for diluting kinase protein.

Kinase Dilution Buffer VII

Reference: K27-09-01

€0.00 (tax incl.)

Solution of buffer used for diluting kinase protein.

Kinase Dilution Buffer VIII

Reference: K28-09-20

€0.00 (tax incl.)

Solution of buffer used for diluting kinase protein.

Kinase Dilution Buffer VIII

Reference: K28-09-05

€0.00 (tax incl.)

Solution of buffer used for diluting kinase protein.

Kinase Dilution Buffer VIII

Reference: K28-09-01

€0.00 (tax incl.)

Solution of buffer used for diluting kinase protein.

Kinase Dilution Buffer X

Reference: K20-09-20

€0.00 (tax incl.)

The working solution used for diluting kinase proteins.

Kinase Dilution Buffer X

Reference: K20-09-05

€0.00 (tax incl.)

The working solution used for diluting kinase proteins.

Kinase Dilution Buffer X

Reference: K20-09-01

€0.00 (tax incl.)

The working solution used for diluting kinase proteins.

KRIBIOLISA™ CHO Host Cell DNA Kit

Reference: KBBR02

€0.00 (tax incl.)

Immunoassay for the measurement of HEK Host Cell Proteins. For the production of biotechnological products, expression of therapeutic proteins in CHO cells is commonly used. Due to which there is a possibility of DNA...

KRIBIOLISA™ E.coli Host Cell DNA Kit

Reference: KBBR01

€0.00 (tax incl.)

For the production of biotechnological products, expression of therapeutic proteins in E.coli cells is commonly used. Due to which there is a possibility of DNA contamination from the host cells in the products which...

KRIBIOLISA™ Human IgG4

Reference: KBI1007

€0.00 (tax incl.)

Immunoassay for the quantification of Human IgG in cell culture and biological samples. About the kit: - Uses anti-idiotypic antibodies sourced from our vendor partner in the US, which ensures higher specificity,...

KRIBIOLISA™ Insect Cell Host Cell DNA Kit

Reference: KBBR03

€0.00 (tax incl.)

For the production of biotechnological products, expression of therapeutic proteins in insect cells is commonly used. Due to which there is a possibility of DNA contamination from the host cells in the products which...

KRIBIOLISA™ Protein L Ligand Detection Kit

Reference: KBBP50

€0.00 (tax incl.)

Enzyme Immunoassay for the Quantitative determination of Protein L Ligand Detection from medium containing immunoglobulin (Ig) or Ig-fragments

KRISHZYME™ Chymotrypsin Enzymatic Assay Kit

Reference: KBBA06

€0.00 (tax incl.)

KRISHZYME™ Dalteparin Factor IIa Assay Kit

Reference: KBBA03D

€0.00 (tax incl.)

Chromogenic assay for testing Dalteparin in purified systems by measurement of factor IIa inhibition activity.

KRISHZYME™ Dalteparin Factor Xa Assay Kit

Reference: KBBA04D

€0.00 (tax incl.)

Chromogenic assay for testing Dalteparin in purified systems by measurement of factor Xa inhibition activity.

KRISHZYME™ Enoxaparin Factor IIa Assay Kit

Reference: KBBA03ES

€0.00 (tax incl.)

Chromogenic assay for testing Enoxaparin in purified systems by measurement of factor IIa inhibition, in compliance with pharmacopoeias (EP/BP) and FDA guidelines About the kit: - Uses anti-idiotypic antibodies...

KRISHZYME™ Enoxaparin Factor Xa Assay Kit

Reference: KBBA04ES

€0.00 (tax incl.)

Chromogenic assay for testing Enoxaparin in purified systems by measurement of factor Xa inhibition, in compliance with pharmacopoeias (EP/BP) and FDA guidelines About the kit: - Uses anti-idiotypic antibodies...

KRISHZYME™ Enoxaparin Factor Xa Assay Kit - 200 Tests

Reference: KBBA04E

€0.00 (tax incl.)

Enoxaparin Factor Xa is a chromogenic assay intended for the quantitative determination of enoxaparin in purified solutions by measurement of factor Xa inhibition activity.

KRISHZYME™ Heparin Factor IIa Assay Kit

Reference: KBBA03S

€0.00 (tax incl.)

Chromogenic assay for testing Heparins (UFH) in purified systems by measurement of Factor IIa inhibition, in compliance with EP Pharmacopoeia. About the kit: - Uses anti-idiotypic antibodies sourced from our vendor...

KRISHZYME™ Heparin Factor Xa Assay Kit

Reference: KBBA04S

€0.00 (tax incl.)

Chromogenic assay for testing Heparins (UFH) in purified systems by measurement of Factor Xa inhibition, in compliance with EP Pharmacopoeia. About the kit: - Uses anti-idiotypic antibodies sourced from our vendor...

KRISHZYME™ Heparin Factor Xa Assay Kit - 200 Tests

Reference: KBBA04

€0.00 (tax incl.)

Heparin Factor Xa is a chromogenic assay intended for the quantitative determination of unfractioned heparin (UFH) in purified solutions by measurement of factor Xa inhibition activity.

KRISHZYME™ Hyaluronidase Enzymatic Assay Kit

Reference: KBBA05

€0.00 (tax incl.)

Enzymatic Assay for Quantification of Hyaluronidase activity in cell culture supernatant and pharmaceutical preparations Hyaluronidase is a family of enzymes that degrade hyaluronic acid by catalyzing the hydrolysis...

KRISHZYME™ Nadroparin Factor IIa Assay Kit

Reference: KBBA03N

€0.00 (tax incl.)

Nadroparin Factor lla is a chromogenic assay intended for the quantitative determination of Nadroparin in purified&solutions by measurement of factor IIa inhibition activity.

KRISHZYME™ Nadroparin Factor Xa Assay Kit

Reference: KBBA04N

€0.00 (tax incl.)

Nadroparin Factor Xa is a chromogenic assay intended for the quantitative determination of Nadroparin in purified&solutions by measurement of factor Xa inhibition activity.

KRISHZYME™ Prekallikrein Activator Assay Kit

Reference: KBBA30EP

€0.00 (tax incl.)

KRISHZYME Plasma Kallikrein Activitor Assay Kit utilizes the ability of active plasma kallikrein to cleave a synthetic pNA-based peptide substrate to release pNA, which can be easily quantified using a microplate...

KRISHZYME™ Streptokinase/Streptodornase Assay Kit

Reference: KBBA15

€0.00 (tax incl.)

KRISHZYME™ Tinzaparin Factor IIa Assay Kit

Reference: KBBA03T

€0.00 (tax incl.)

Tinzaparin Factor lla is a chromogenic assay intended for the quantitative determination of Tinzaparin in purifiedsolutions by measurement of factor IIa inhibition activity.

KRISHZYME™ Tinzaparin Factor Xa Assay Kit

Reference: KBBA04T

€0.00 (tax incl.)

Tinzaparin Factor Xa is a chromogenic assay intended for the quantitative determination of Tinzaparin in purified solutions by measurement of factor Xa inhibition activity.