Category: Research kits

Filter By
Brand: Signalchem Brand: Vazyme Clear all
3CLpro FRET Substrate 3CLpro FRET Substrate

3CLpro FRET Substrate

Reference: CL01-58-1000
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for 3CLpro.
3CLpro FRET Substrate 3CLpro FRET Substrate

3CLpro FRET Substrate

Reference: CL01-58-500
€0.00 (tax incl.)
Synthetic FRET peptide substrate specific for 3CLpro.
Acetyltransferase Assay Buffer Acetyltransferase Assay Buffer

Acetyltransferase Assay Buffer

Reference: A01-09-20
€0.00 (tax incl.)
5X stock solution of the buffer used for assaying histone acetyltransferases (KAT).
Acetyltransferase Assay Buffer Acetyltransferase Assay Buffer

Acetyltransferase Assay Buffer

Reference: A01-09-05
€0.00 (tax incl.)
5X stock solution of the buffer used for assaying histone acetyltransferases (KAT).
Acetyltransferase Assay Buffer Acetyltransferase Assay Buffer

Acetyltransferase Assay Buffer

Reference: A01-09-01
€0.00 (tax incl.)
5X stock solution of the buffer used for assaying histone acetyltransferases (KAT).
Add&Read Human Fc Kit Add&Read Human Fc Kit

Add&Read Human Fc Kit

Reference: DD2102-02
€0.00 (tax incl.)
Add&ReadTM Human Fc Kit can be used to detect the concentration of Human IgG or hFc-fusion protein (hFc-fusion protien) in the cell supernatant or after purification. There is an antibody in the kit that recognizes...
Add&Read Human Fc Kit Add&Read Human Fc Kit

Add&Read Human Fc Kit

Reference: DD2102-01
€0.00 (tax incl.)
Add&ReadTM Human Fc Kit can be used to detect the concentration of Human IgG or hFc-fusion protein (hFc-fusion protien) in the cell supernatant or after purification. There is an antibody in the kit that recognizes...
Add&Read Human IgG Kit Add&Read Human IgG Kit

Add&Read Human IgG Kit

Reference: DD2101-02
€0.00 (tax incl.)
Add&ReadTM Human IgG Kit can be used to detect the concentration of Human IgG (hlgG) in the cell supernatant or after purification. There are two antibodies that recognize hIgG in the kit, namely: the antibody that...
Add&Read Human IgG Kit Add&Read Human IgG Kit

Add&Read Human IgG Kit

Reference: DD2101-01
€0.00 (tax incl.)
Add&ReadTM Human IgG Kit can be used to detect the concentration of Human IgG (hlgG) in the cell supernatant or after purification. There are two antibodies that recognize hIgG in the kit, namely: the antibody that...
AKT (PKB) Substrate AKT (PKB) Substrate

AKT (PKB) Substrate

Reference: A05-58
€0.00 (tax incl.)
The AKT (PKB) Substrate peptide sequence (CKRPRAASFAE) is based on the N-terminus of GSK3.
AKT (SGK) Substrate AKT (SGK) Substrate

AKT (SGK) Substrate

Reference: A08-58
€0.00 (tax incl.)
The AKT (SGK) Substrate peptide sequence (RPRAATF) is based on the N-terminus of GSK3.
AMP Solution AMP Solution

AMP Solution

Reference: A46-09-500
€0.00 (tax incl.)
0.5mM AMP solution used for AMPK family kinase assays.
ATP Stock Solution ATP Stock Solution

ATP Stock Solution

Reference: A50-09-200
€0.00 (tax incl.)
10 mM ATP Stock Solution used for preparing hot ATP assay cocktail.
BCA Protein Quantification Kit BCA Protein Quantification Kit

BCA Protein Quantification Kit

Reference: E112-02
€0.00 (tax incl.)
The BCA Protein Quantification Kit is currently one of the most sensitive protein determination methods. Under alkaline conditions, the protein reduces Cu2+ to Cu+, and Cu+ interacts with the unique BCA Reagent A...
BCA Protein Quantification Kit BCA Protein Quantification Kit

BCA Protein Quantification Kit

Reference: E112-01
€0.00 (tax incl.)
The BCA Protein Quantification Kit is currently one of the most sensitive protein determination methods. Under alkaline conditions, the protein reduces Cu2+ to Cu+, and Cu+ interacts with the unique BCA Reagent A...
Ca2+/Calmodulin Solution II, 10x Ca2+/Calmodulin Solution II, 10x

Ca2+/Calmodulin Solution II, 10x

Reference: C02-39B-500
€0.00 (tax incl.)
10x stock solution used for assaying activity of calcium-calmodulin-activated protein kinase enzymes.
CaCl2 Solution CaCl2 Solution

CaCl2 Solution

Reference: C02-09-25
€0.00 (tax incl.)
25 μl volume of 1 M CaCl2 solution for different enzyme assays.
cAMP Solution cAMP Solution

cAMP Solution

Reference: A47-09-500
€0.00 (tax incl.)
500ul volume of 100uM cAMP solution for different enzyme assays.
CCK-8 Cell Counting Kit CCK-8 Cell Counting Kit

CCK-8 Cell Counting Kit

Reference: A311-02
€0.00 (tax incl.)
CCK-8 Cell Counting Kit, referred to as CCK-8 kit, is dependent on WST-8 (2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5- (2,4-Disulfobenzene)-2H-tetrazole monosodium salt) is a fast, highly sensitive,...
CCK-8 Cell Counting Kit CCK-8 Cell Counting Kit

CCK-8 Cell Counting Kit

Reference: A311-01
€0.00 (tax incl.)
CCK-8 Cell Counting Kit, referred to as CCK-8 kit, is dependent on WST-8 (2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5- (2,4-Disulfobenzene)-2H-tetrazole monosodium salt) is a fast, highly sensitive,...
cGMP Solution cGMP Solution

cGMP Solution

Reference: G47-09-500
€0.00 (tax incl.)
500ul volume of 100uM cGMP solution for different enzyme assays.
CK2 Substrate CK2 Substrate

CK2 Substrate

Reference: C08-58
€0.00 (tax incl.)
The synthetic peptide (RRRADDSDDDDD) contains serine protein kinase phosphorylation site surrounded by acidic residues and is high selectively evaluated as a substrate for CK2 family kinases.
D-Fructose-6-phosphate D-Fructose-6-phosphate

D-Fructose-6-phosphate

Reference: F520-59-10
€0.00 (tax incl.)
D-Fructose-6-phosphate (sodium salt hydrate) is supplied as a crystalline solid.
D-Glucose-6-phosphate D-Glucose-6-phosphate

D-Glucose-6-phosphate

Reference: F521-59-10 mg
€0.00 (tax incl.)
D-glucose-6-phosphate (sodium salt) is supplied as a crystalline solid.
DNMT Substrate-1 DNMT Substrate-1

DNMT Substrate-1

Reference: D53-58-05
€0.00 (tax incl.)
The synthetic double-stranded oligonucleotide (Sense: 5’- GATCCGACGACGACGCGCGCGCGACGACGAGATC; Anti-sense: 5’- GATCTCGTCGTCGCGCGCGCGTCGTCGTCGGAC) is used as a substrate for DNA methyltransferase 3A (DNMT3A).
DTT Solution DTT Solution

DTT Solution

Reference: D86-09B-10
€0.00 (tax incl.)
0.1 M DTT solution used for preparing protein kinase assay buffer.
DTT Solution DTT Solution

DTT Solution

Reference: D86-09-10
€0.00 (tax incl.)
1 M DTT solution used for preparing protein kinase assay buffer.
Dual Luciferase Reporter Assay Kit Dual Luciferase Reporter Assay Kit

Dual Luciferase Reporter Assay Kit

Reference: DL101-01
€0.00 (tax incl.)
The Dual Luciferase Reporter Assay Kit is used to detect the fluorescence intensity of the Luciferin substrate after the reporter plasmid is transfected into the cells, so as to reflect the expression of luciferase...
DUB Substrate I DUB Substrate I

DUB Substrate I

Reference: U06-57-10
€0.00 (tax incl.)
The ubiquitin-based proluciferin substrate is based on the C-terminal derivative of Ubiquitin.
DUB Substrate II DUB Substrate II

DUB Substrate II

Reference: S293-57-10
€0.00 (tax incl.)
The SUMO1-based proluciferin substrate is based on the C-terminal derivative of SUMO1.
DUB Substrate III DUB Substrate III

DUB Substrate III

Reference: N263-57-10
€0.00 (tax incl.)
The NEDD8-based proluciferin substrate is based on the C-terminal derivative of NEDD8.
GSK3 Substrate GSK3 Substrate

GSK3 Substrate

Reference: G50-58
€0.00 (tax incl.)
The GSK3 sub peptide sequence (YRRAAVPPSPSLSRHSSPHQ(pS)EDEEE) is based on human muscle glycogen synthase 1 (amino acid 636-661).
GTP Solution GTP Solution

GTP Solution

Reference: G50-09-500
€0.00 (tax incl.)
500ul volume of 5uM GTP solution for different enzyme assays.
GTP Solution II GTP Solution II

GTP Solution II

Reference: G50-09B-100
€0.00 (tax incl.)
100μl volume of 5mM GTP solution for different enzyme assays.
HER2 Substrate HER2 Substrate

HER2 Substrate

Reference: E27-58
€0.00 (tax incl.)
The HER2 Substrate synthetic peptide [AAEEIYAARRG] is routinely evaluated as a substrate for HER2.
Kinase Assay Buffer I Kinase Assay Buffer I

Kinase Assay Buffer I

Reference: K01-09-20
€0.00 (tax incl.)
Stock solution of buffer used for assaying kinase protein.
Kinase Assay Buffer I Kinase Assay Buffer I

Kinase Assay Buffer I

Reference: K01-09-05
€0.00 (tax incl.)
Stock solution of buffer used for assaying kinase protein.
Kinase Assay Buffer I Kinase Assay Buffer I

Kinase Assay Buffer I

Reference: K01-09-01
€0.00 (tax incl.)
Stock solution of buffer used for assaying kinase protein.
Kinase Assay Buffer II Kinase Assay Buffer II

Kinase Assay Buffer II

Reference: K02-09-20
€0.00 (tax incl.)
Stock solution of buffer used for assaying kinase protein.
Kinase Assay Buffer II Kinase Assay Buffer II

Kinase Assay Buffer II

Reference: K02-09-05
€0.00 (tax incl.)
Stock solution of buffer used for assaying kinase protein.
Kinase Assay Buffer II Kinase Assay Buffer II

Kinase Assay Buffer II

Reference: K02-09-01
€0.00 (tax incl.)
Stock solution of buffer used for assaying kinase protein.
Kinase Assay Buffer III Kinase Assay Buffer III

Kinase Assay Buffer III

Reference: K03-09-20
€0.00 (tax incl.)
The 5x stock solution used for assaying kinase proteins.
Kinase Assay Buffer III Kinase Assay Buffer III

Kinase Assay Buffer III

Reference: K03-09-05
€0.00 (tax incl.)
The 5x stock solution used for assaying kinase proteins.
Kinase Assay Buffer III Kinase Assay Buffer III

Kinase Assay Buffer III

Reference: K03-09-01
€0.00 (tax incl.)
The 5x stock solution used for assaying kinase proteins.
Lipid Dilution Buffer Lipid Dilution Buffer

Lipid Dilution Buffer

Reference: L21-09-20
€0.00 (tax incl.)
The working solution used for diluting lipid substrates.
Lipid Dilution Buffer Lipid Dilution Buffer

Lipid Dilution Buffer

Reference: L21-09-05
€0.00 (tax incl.)
The working solution used for diluting lipid substrates.
Lipid Dilution Buffer Lipid Dilution Buffer

Lipid Dilution Buffer

Reference: L21-09-01
€0.00 (tax incl.)
The working solution used for diluting lipid substrates.
Lipid Kinase Buffer Lipid Kinase Buffer

Lipid Kinase Buffer

Reference: L01-09-20
€0.00 (tax incl.)
The 5x stock solution of buffer used for assaying lipid kinase proteins.
Lipid Kinase Buffer Lipid Kinase Buffer

Lipid Kinase Buffer

Reference: L01-09-05
€0.00 (tax incl.)
The 5x stock solution of buffer used for assaying lipid kinase proteins.
Lipid Kinase Buffer Lipid Kinase Buffer

Lipid Kinase Buffer

Reference: L01-09-01
€0.00 (tax incl.)
The 5x stock solution of buffer used for assaying lipid kinase proteins.

Menu

Settings

Please sign in first.

Sign in